Chst10 antibody thermo
WebBuy rabbit polyclonal antibody to CHST10 (A37117). Validated Applications: WB and IHC. Tested Reactivity: Human. ️ Low Prices ️ 100% Guarantee WebAnti-CHST10 Antibody Products from Thermo Fisher Scientific Anti-CHST10 antibodies are offered by a number of suppliers. This target gene encodes the protein 'carbohydrate …
Chst10 antibody thermo
Did you know?
WebFeb 2, 2013 · A Chst10 targeting vector was constructed as shown in Fig. 1. Homologously recombined ES clones were selected by Southern hybridization using a probe adjacent to the targeting vector. Probe DNA (about 450 bp) was amplified by PCR using the following primers: 5–12s, TGTAGTCAAGGCAGCAACCAAGCA, and 5–13a, … WebA superior strategy for validation of antibody: Blocking peptide validation; Independent Antibody Verification; phospho-antibody made by Affinity; Fruit fly studies guide investigators to misregulated mechanism in human cancers; G Protein-Coupled Receptors (GPCRs) win 2012 Nobel Prize in Chemistry
WebCHST10 (HNK-1ST) protein expression summary. We use cookies to enhance the usability of our website. If you continue, we'll assume that you are happy to receive all cookies. ... Antibody specificity analysis with protein arrays. Predicted and matching interactions are shown in green. Antibody dilution: 1:3000: 1:500: ANTIGEN INFORMATION; WebIHC-P analysis of human lung carcinoma tissue using GTX87551 CHST10 antibody. The picture on the right is blocked with the synthesized peptide. GTX87551 WB Image WB analysis of HUVEC cell lysates using …
WebCHST10 Polyclonal Antibody Product Details Size 100 µL Species Reactivity Human, Mouse, Rat Host / Isotype Rabbit / IgG ... Conjugate Unconjugated Immunogen A synthesized peptide derived from human CHST10, corresponding to a region within the internal amino acids. Form Liquid Concentration 1mg/mL Purification Affinity … WebThere are currently no images for Carbohydrate Sulfotransferase 10/CHST10 Antibody (NBP2-97238R). Every product we sell is backed by Novus' 100% Guarantee . If you …
WebCHST10 Antibodies. Antibodies that detect CHST10 can be used in several scientific applications, including Western Blot, Immunohistochemistry, Immunocytochemistry and …
WebBest Art Classes in Fawn Creek Township, KS - Elaine Wilson Art, Tallgrass Art Gallery, Bevs Ceramic Shed, MillieArt granny greaseWebCompare Anti-CHST10 Immunohistochemistry Antibody Products from leading suppliers on Biocompare. View specifications, prices, citations, reviews, and more. granny griff durban northWebRabbit polyclonal antibody raised against synthetic peptide of CHST10.IgGy Antibody Selector – Quickly search hundreds of thousands of antibodies available for … chinos near houstontx puerto rican foodWebCHST10 Antibody (PA5-106630) in ICC/IF. Immunofluorescent analysis of CHST10 in HUVEC cell lysate. Samples were fixed with paraformaldehyde, permeabilized with 0.1% … chinos new bandWebRabbit Polyclonal CHST10 antibody Internal Region for ELISA, ICC, IF, IHC, WB. Order anti-CHST10 antibody ABIN6258961. language English local_shipping United States phone+1 877 302 8632; Contact; person Login favorite_border Comparison List shopping_cart Basket menu; north; arrow_back. search. search. Phone: +1 877 302 … chinosol apothekeWebCHST10, Rabbit, Monoclonal Antibody, Abnova™-Rabbit monoclonal antibody raised against a human CHST10 peptide using ARM Technology. Fisher Scientific Fisher Healthcare granny green beans recipeWebCHST10, Rabbit anti-Human, Polyclonal Antibody, Abnova™-Rabbit Polyclonal Antibody granny grey beard